04-04-2020
Mathematics

contestada

3.868×10 9 =?
What is this answer?

Respuesta :

lianelysp lianelysp

04-04-2020

The answer is 421.612

Answer Link

Otras preguntas

PLEASE HELP ME!! What was the name of the system developed by FDR Roosevelt during the Great Depression to aid lower income people? B) Medicare C) M

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Name all of the traits that the mackerel has, based on this cladogram.

Can you give me a short summary (only in 1 or 2 sentences) on Shakespeare’s Macbeth. And what it is.

Write each statement as an algebraic expression. The product of two numbers, p and q, decreased by three times their sum.

The bretton woods system ended in select one: a. 1945. b. 1973. c. 1981. d. 2001.

what is the absolute value of the complex number -4 — √2i

I’m confused !!! Help

If an employee gets potentially infectious material splashed in his eye, what should he do?

31. The skin, lungs, and digestive system __________. A. transport broken-down chemicals out of the body B. are not affected by drugs C. always speed up when dr